EST details — SGN-E545268

Search information 
Request: 545268Match: SGN-E545268
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193366Clone name: TUS-68-A12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C100644 [cLEZ-9-E1] Trace: SGN-T122205 EST: SGN-E311600 Direction: 5' Facility: TIGR
Clone: SGN-C193366 [TUS-68-A12] Trace: SGN-T350054 EST: SGN-E549179 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545268Length: 572 bp (907 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545268 [] (trimmed) GGTCCTTTGGAGGCGGGAAAGAAAGAAAAGTAAAACCCAACTCATGTATGATGAAGCTGTGGTCTTCTCAACCTTTCTTCTTCTCGTTAAAAATG
ACATTTTCAAACGAAGTAATACTAGACGAAGTACTACAGATACTAAGAGATACTCTACATAAGTAAGAATTCATCTAAGCCTATGACGAAATGGA
AGAAGTGGTAAAGCTAATAACTATACATCTTAAGGCTTGTCATCAATATCTCTACTAGCGAAACATAGCTTCTCTTGTCTCGAGGTTTATCCCCA
TTACGCAAAGCGCTGCCATCTCAGAACCGCCCTCACACACAAAGGGCACTTCCAAGAGCTTGGATGTGATCACCCGAAAAAGGCCAGGAAGCTCA
GCGTCCCCTTTTCTGAGCCTCATGTTTTGAAACCTCAAACTTGGTCCCACCTCGGCCTCTTGGCGGAGCACATTGGGCCTGCTTGATTTTCCGCA
ACCGAATATTCCAGCGAGTTCAACCATTGTAAGAACTTTCAGATGTGGAGATCCTTTACCGCCGTTAATGTGCGTCTTCACCTGAGCACCGGTTA
AG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545268] SGN-U597255 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346143 [Download][View] Facility Assigned ID: TUS68A12_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0333 Quality Trim Threshold: 14.5