EST details — SGN-E545318

Search information 
Request: 545318Match: SGN-E545318
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193395Clone name: TUS-68-B17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C100837 [cLEZ-9-P9] Trace: SGN-T122421 EST: SGN-E311816 Direction: 5' Facility: TIGR
Clone: SGN-C193395 [TUS-68-B17] Trace: SGN-T350062 EST: SGN-E549187 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545318Length: 812 bp (893 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545318 [] (trimmed) AAGATCACAATGCGCATGTATATATGCCTAGCACAACTGTAAAATTCATAAAACTGCATGGAGATGAGGGCAGAATGCAATTCGCATAAATGGTG
AAAGGTTTAAATGAGATGATAGTCAAGCAAATCAAAACTTGAAACCTAACACCGAAGATTTTCCACTGGGAAAACAGAATGGGCACTTGATTCAA
AATGGCTACGCGATTGAAGGTCGATTCTTCTTCCCATAGCAGATGTCTGACAAAACTGCCCAGATTAAGGCTGCTGCGTGGTTGCTGCTGCAGCT
GGCCGAGGGTTCTGCTGATGTGCGGCTAGCTGAACACTAGGTGGTGGGTGTGCAGTAGCTTGATAAGGTGGAGGAGGATATTGATGATAAGGTGG
AGGAGGTGGTGGCATATATCCATAAGCTGGACGATAATAAGGTGTAAGTTACAAAAGCACAACCACGCTGGACCACCATTTTAATGGACTCAATT
TCACCATGTGCATAAAAATGGTCCCTAAGGTCCTGCTCAGTGATTCTTGCATCAACACCACCCACATAGAGGGTTCTAATGCTCTCGTCATCAGG
GGGCTCCAATGAAGGCATTTCACCTGCTTTATTAAGTAGCTTTAAAGCCACTGGATCATTGACTCCATAGTAACGGTCTTTGATATTTTGCTGTG
ACAATTCCCCTGTTTCAGGCATCTCATGCCGGTAAGGACACTCCAAACCTCTTGTACATTGACCACGTATGTAGAAACTGCAAACATGTGCCCGA
TTTCTCTTGTAGTATGGAGTTGTTCTTTGAAGCTTCATGATAGTATCATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545318] SGN-U592817 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346193 [Download][View] Facility Assigned ID: TUS68B17_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0011 Quality Trim Threshold: 20.5