EST details — SGN-E545330

Search information 
Request: 545330Match: SGN-E545330
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193402Clone name: TUS-68-B24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C98485 [cLEZ-10-C15] Trace: SGN-T122548 EST: SGN-E309878 Direction: 5' Facility: TIGR
Clone: SGN-C193402 [TUS-68-B24] Trace: SGN-T350064 EST: SGN-E549189 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545330Length: 461 bp (904 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545330 [] (trimmed) AAATAACTATCAACAGAGGACCACCATAATTTGATTCAAAAGTTAAAATTAATGTAGAGACTCAGCGGCAAAGTAATCAATAACTATGATATTCG
CCAAAGGGAGTTGTGAGCCAATACAGTGAAACATAGCAGCCTCTACCGCCACTGCAATGCATCCAGAGCTTCTTGGTGAACTTCTTTATCACCGG
CTGCCACTACATTAAAACTTGTGGCTGGTGAACCAGCAGAAGCTTTCCAATTAAAATGTTGGCCTTTCCAGTCGGTTATTGTTCCTCCAGCACCT
TCTATTACTGGTACAAGTGAGAGGAAGTCGTACGGCTTAAGACCAGACTCTACTACAAGATCCACAAATCCAGAAGCCAATAGGGCATAAGCATA
GCAGTCACATCCGTACAGTGGAACTTTCACCTTGCTTCTAACACGAGCAAAGGCAATCTCAGCATCCCCTTCGAACAAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545330] SGN-U577734 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346205 [Download][View] Facility Assigned ID: TUS68B24_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5