EST details — SGN-E545460

Search information 
Request: 545460Match: SGN-E545460
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193478Clone name: TUS-68-F4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C99035 [cLEZ-15-J1] Trace: SGN-T122974 EST: SGN-E310759 Direction: 5' Facility: TIGR
Clone: SGN-C193478 [TUS-68-F4] Trace: SGN-T346336 EST: SGN-E545461 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545460Length: 541 bp (865 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545460 [] (trimmed) CCCCAAAAAAAGGAACTTGCTTCCCATTGAAATAAATTTCCCGAACCTTTCAAAATTTAAAATTTAAATGACAAACCATTTCCAACCCAAAGAAC
AAAAGGGAAAAATATGGGAACTTGCTTTTTGAGCTGGGAAAAGGGAAATTTAATAATTTGGAGGGGGGGGTGATGGAAAAGGTAATGGCTCCTTC
TTGACGCCTTTTTTTGAAAAAAAAAACCCCTTGTTTTCTTCTTTAGGCCCTGGGGGTCCCTTTGGAACATATGACCCCCCTTTGTAGTTTTCTTT
TGAAACTATGGGCTCCTTGTAGAAGCCTTTTTTTGGCAAAAAAGGCCCCTTATCCCCTTCTTTAGGCCCTGAGGGCCCCTTTAAAACAAAGGGAC
CCTTTTGGTAGTTATCTCCGGAAACTGATGACATCTTGAAGAATTCTTTCTTTGACAAAAAAGGCCCCTTGTATCCTTCTTTAGGCCCGGAGGGC
CCCTTTGGAACATATGAAACCTTTTTGTAGTTATCTCCAAAAGCTGAGGGCTTCTTGGAGAAGCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545460] SGN-U604738 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346335 [Download][View] Facility Assigned ID: TUS68F04_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.900 Expected Error Rate: 0.0290 Quality Trim Threshold: 14.5