EST details — SGN-E545542

Search information 
Request: 545542Match: SGN-E545542
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193525Clone name: TUS-68-H3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C99369 [cLEZ-17-E1] Trace: SGN-T123406 EST: SGN-E310981 Direction: 5' Facility: TIGR
Clone: SGN-C193525 [TUS-68-H3] Trace: SGN-T346416 EST: SGN-E545541 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545542Length: 550 bp (917 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E545542 [] (trimmed) GCAAAATTTGAACCTACAAAAATTTTCTCCATTTTTATAGCAAATTTCTTCCATAAATGGCTGGTAGAGGCAAAACCCTAGGTTCAGGAACAGCA
AAAAAGGCTACTTCTCGTAGTAGCAAAGCTGGTCTTCAGTTTCCGGTTGGTCGTATTGCTCGGTTTTTGAAAGCCGGGAAGTATGCTGAACGTGT
CGGTGCCGGAGCTCCGGTTTATCTAGCTGCTGTTCTGGAGTACCTTGCTGCTGAGGTTCTTGAGTTAGCTGGAAATGCAGCAAGGGACAACAAGA
AGACTAGGATCGTTCCGAGGCATATTCAATTGGCAGTGAGGAACGATGAGGAACTAAGCAAACTTCTCGGAGATGTAACGATTGCCAATGGCGGT
GTGATGCCCAACATTCACAACCTTCTGCTTCCAAAGAAAACCGGTGGTTCAAAGCCATCTGCTGATGAAGATTAAACATATTCAAGACTTGGTTT
TTCTTAGTTTATAGCTCTTTGTTCTTTTTCTGGAATAGTATTAAGGATTTGCTAGTGTTTCTTTAGGTGTTTAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545542] SGN-U577216 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346417 [Download][View] Facility Assigned ID: TUS68H03_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0007 Quality Trim Threshold: 12.5