EST details — SGN-E545565

Search information 
Request: 545565Match: SGN-E545565
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193539Clone name: TUS-68-H17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C99465 [cLEZ-17-L11] Trace: SGN-T123467 EST: SGN-E311042 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545565Length: 532 bp (895 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545565 [] (trimmed) GCGGAAGAAAGGATGTTTAATAAGCATCTTAAATGGCTTACATAAGATGGGCCAAGCATATAAATGAACACTTAACTGAAATAAATTTAATCTCT
ATGATACTGTCGGAAACAGATTTTCTAGTTTATCTTTAGAATGTGAAAAAACAAAGATTACAGTTATTATTTTCTGCATCCAAAACAGATTGTCA
GAGATGCATCAACCCGCCAAGACTACCATAAACCTCAAGCAACTTTGTGCTGTTCCATTAATTGTGTTCAAGTACCATGATACAGCTCGCAGCAA
GCCCGCACATTAACTGTCAAGTGAGAAGTCAATCGAGTTCCAGCCACCACATTATGCAGAGGCAAAAATGACTGAGTACACCCCAAAGCTCCCAA
TGTCCTGGGACTGGTGAATGAGAAGCGGCGCGTGTTGGAACGAGTGCCGGAGATCGGAGGAGTGCGAACGCGGTTAACGGTCGGAGATGAACGGG
AAGTGGAAGCTCTAGCGACGGAAGTGAGTGATCTGGTGACGGAACCACGCCAAGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545565] SGN-U566437 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346440 [Download][View] Facility Assigned ID: TUS68H17_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5