EST details — SGN-E545646
| Search information |
| Request: 545646 | Match: SGN-E545646 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C193586 | Clone name: TUS-68-J16 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C99723 [cLEZ-18-P16] | Trace: SGN-T123716 | EST: SGN-E311501 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C193586 [TUS-68-J16] | Trace: SGN-T350116 | EST: SGN-E549241 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E545646 | Length: 115 bp (830 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E545646 [] (trimmed)
CGGCACAGCAATAATATAATCAGTTTAGTCTCACAAGTAAGGTTTAGGAAGGTTAGGTGTACGCGCACCTTACTCCTATTTTTGGTACATATTAT
GCATTTAGTATATTTCGTAA
GCATTTAGTATATTTCGTAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E545646] | SGN-U563057 | Tomato 200607 | Build 2 | 11 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T346521 [Download][View] | Facility Assigned ID: TUS68J16_P1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.906 | Expected Error Rate: 0.0012 | Quality Trim Threshold: 14.5 |
Working
