EST details — SGN-E545646
Search information |
Request: 545646 | Match: SGN-E545646 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C193586 | Clone name: TUS-68-J16 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C99723 [cLEZ-18-P16] | Trace: SGN-T123716 | EST: SGN-E311501 | Direction: 5' | Facility: TIGR |
Clone: SGN-C193586 [TUS-68-J16] | Trace: SGN-T350116 | EST: SGN-E549241 | Direction: 5' | Facility: INRA (MWG) |
Sequence |
Sequence Id: SGN-E545646 | Length: 115 bp (830 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E545646 [] (trimmed)
CGGCACAGCAATAATATAATCAGTTTAGTCTCACAAGTAAGGTTTAGGAAGGTTAGGTGTACGCGCACCTTACTCCTATTTTTGGTACATATTAT
GCATTTAGTATATTTCGTAA
GCATTTAGTATATTTCGTAA
Unigenes |
Current Unigene builds | |||||
[SGN-E545646] | SGN-U563057 | Tomato 200607 | Build 2 | 11 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T346521 [Download][View] | Facility Assigned ID: TUS68J16_P1 |
Submitter: Koni | Sequencing Facility: INRA (MWG) |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.906 | Expected Error Rate: 0.0012 | Quality Trim Threshold: 14.5 |