EST details — SGN-E546437

Search information 
Request: 546437Match: SGN-E546437
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194047Clone name: TUS-69-M21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C102385 [cLHT-24-L1] Trace: SGN-T170521 EST: SGN-E358961 Direction: 5' Facility: TIGR
Clone: SGN-C194047 [TUS-69-M21] Trace: SGN-T347313 EST: SGN-E546438 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546437Length: 436 bp (1022 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E546437 [] (trimmed) AATTCGTGTCCCTATCTAGAGCGTCATATGACTGGTACACTAGAAGAAGTGTGGTTTCTGCACTTGAACAAGAAACAAACTCAACCGACAATCAC
AGTTCGTAAGTATTTTGACACGCTAATTTCTTTTGGAGAGAAAAACAAGGCTACAAGTATTTTGACACACTACAATGTCCTACAAACCTCCAATA
ACCACTACAAAGTAGGATCAGGAAAACACCCGGAAATTTCTTCATAAAGGTTTTAAGACATTGCATGTACTTGTGGATTTTTCATAAGTTTGATT
TATTAAATCCTTCAAGGAAGGAAAGAAATCTGCCCAACTTTAGAGAATGTAAAGAAAATAAAAAAAGAATGCAAGGCATCCTGCACCTCAAGTAC
TTGAATTGAAGTAGAAAATAAATTATTCTGCTGCCTTGGGAGGGCCCTTCCACTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546437] SGN-U577368 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347312 [Download][View] Facility Assigned ID: TUS69M21_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0075 Quality Trim Threshold: 20.5