EST details — SGN-E546810

Search information 
Request: 546810Match: SGN-E546810
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194264Clone name: TUS-70-F22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C106148 [cLPP-1-P6] Trace: SGN-T174721 EST: SGN-E362660 Direction: 5' Facility: TIGR
Clone: SGN-C194264 [TUS-70-F22] Trace: SGN-T347686 EST: SGN-E546811 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546810Length: 801 bp (894 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E546810 [] (trimmed) AAATTTAATCGTTCTTTACTTATCAAAAGCATTCGATCACACACTTTTCAAACTTTTCATTATATCCAAAAATAATAATAATCAATGCAACTTTG
CATTCTATTTAATCCTCTTTCAATAGAGGATCTTATTTTGGAAGAAGTTTAATATAAGTAATTAAAACTCTAATTAAACAACCTCCTAATCTTCT
TCTTATTCATTTTTATTTTCTCCATTTAACCATTTTGATGGAGAAAAAAAAATTAATTTCTATATATAATTATTATATGGTTAATAAGTTGCCAG
AATCTTGCTTGTCGTCGCCAAAAATCCGTTGCCGGAAGTCGTCAACCATCATCGGAAGTCCCTGCCGGAGAGAAACAACGGGCTCCCATCCTAAA
AGTTGTTTTGCTTTTGTAATGTCGGGCTTTCTTTTGTGAGGATCATCTTCCGTATTGGGCCTAAATTCTATTTTTGCATTTGGATCTATTGTTTC
TTGCACCACCTTAGCTAGTTCAAGCATGGTGAATTCACCAGGATTCCCAAGGTTGAAAGGACCTACATGATTTCCTTCCATCAACCTCATCAAAC
CTTCAACCAAATCAGAGACAAATTGAAAGCTCCTGGTTTGTTTTCCATCTCCATAAACTGTCATTGGCTCCTTTCTTAAAGCCTGTGCAACAAAA
TTGCTAACAACTCGACCATCATCTATACACATACGTGGTCCATATGTGTTAAAAATCCTAGCAATCCTAACCTCAATGTTGAGTCCTCTATGGTA
GTCCATGGTCAAAGTTTCAGCTGTACGTTTTCCTTCATCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546810] SGN-U597766 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347685 [Download][View] Facility Assigned ID: TUS70F22_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5