EST details — SGN-E547160

Search information 
Request: 547160Match: SGN-E547160
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194467Clone name: TUS-70-O9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C108250 [cLPP-8-F20] Trace: SGN-T172268 EST: SGN-E360392 Direction: 5' Facility: TIGR
Clone: SGN-C194467 [TUS-70-O9] Trace: SGN-T348034 EST: SGN-E547159 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547160Length: 289 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E547160 [] (trimmed) TTTCTCCATACCGAGTCAACCCTCTTCCTCCTTCCCAGAAAAACCCTAGAATCTCCATTCATTCTCACGTTCAAATTATATATATATATATTGAA
TCCAATTTCATAGTCAAATTTCATATTGATTCAGAAATGACATCGGAGATCGAGGTGGTGGAGGAGGTTGAATCGAGAAATGAAGATGAATCATC
GACGTCTACGGCGGTGGTTAACGGTGGTGTAGGTGAGGAGGAGAGCTTGAGGGATGATGTGTATACGGATTGCGCATGAGGGGAGCTGGAGAGAC
TTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547160] SGN-U583683 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348035 [Download][View] Facility Assigned ID: TUS70O09_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5