EST details — SGN-E547195

Search information 
Request: 547195Match: SGN-E547195
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194488Clone name: TUS-70-P6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C108386 [cLPP-8-M23] Trace: SGN-T172197 EST: SGN-E360321 Direction: 5' Facility: TIGR
Clone: SGN-C194488 [TUS-70-P6] Trace: SGN-T348071 EST: SGN-E547196 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547195Length: 329 bp (986 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E547195 [] (trimmed) ACTACTATACAAACCAAAATACATACACGTATTTCATTCAAATTTGTAGCTTACAACTTTTTTTTCCTTTTCAATTTTACTCATTACTGCTTCAT
TACAATGGACTCAAAAATTCACTGTAGATTTTCTTCTGCTAAGGTAACGAGCATGTCTCGAAGAACTCTTTTTATGATCATCATTAAGTCCAGTT
GCAACATTTGGATCTTTTACTTCCTTGACTTGATAATTTAGCAGTGTATCAAGACCATCATCTATCTTGGAGTTTGGTGAGCAGTTTTTGCTGGT
TGCTATCTCTGAGTAATTTAAGCTCAGCTCGGTTACTTCTGACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547195] SGN-U566856 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348070 [Download][View] Facility Assigned ID: TUS70P06_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5