EST details — SGN-E547444

Search information 
Request: 547444Match: SGN-E547444
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194633Clone name: TUS-71-F7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C104123 [cLPP-13-A4] Trace: SGN-T173471 EST: SGN-E361068 Direction: 5' Facility: TIGR
Clone: SGN-C194633 [TUS-71-F7] Trace: SGN-T348320 EST: SGN-E547445 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547444Length: 755 bp (870 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E547444 [] (trimmed) AAATACGTTGATACAACAAACTCTTTCTATTCCACGAACAAAACGCCAGAGATTGGCATCATTGTACACAATTTACATGACAAAATAGGAGTCAC
ATTTGCTCTGTACTTGATATATCTACATGAACCTAAATATTTCCTAATTAAGGCAAAAAAAAAAACATTATGCACATATGATCCTTCTTTCTTTT
TTTTTTCCTTCGAATTTGTGGTTGAATGTTATGATCATGCTTCATTAAAGGATTGAGCACAAGCAGCAACCTTGATAAAAACATCCTCTAAAGTT
GTATCAGCCATACCCCAAGCATAAATTGGAAATCTACTCTTTGCATTCTCAACTAGTTGAAATACATCTGCAATTTTCGATTCATGTTTTGGCAA
CTCGAACTTCTGTGTACCTGATAAATGATACACTTTGTTGGCATTTGGGCATATCTGTCGCACCATTTTCTCCACTTCCACCTCATTATCAGCTG
ATGTAGTTATCGCGAGCACGTAAGACCCTCCATATCTTGTCTTCAACTCTGATGAATTTGCTATGCATTGCAAGCTTCCATCAACGAAGATTCCT
AAGCGATCACATAAATAATCCGCTTCTTCCATTGAATGGGTAGTGAGAATTATCGCTCTGCCTTTCCGTGCATTCTTCACAACAGTCCATAAGGT
ATCTCTTGAAGCTGGATCAAGTCCAGTACTCGGCTCATCCAGGTAGACAACCTTGGGGATTTCCATGAGTTGAATAGCAACACTTAGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547444] SGN-U598076 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348319 [Download][View] Facility Assigned ID: TUS71F07_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0023 Quality Trim Threshold: 20.5