EST details — SGN-E547580
| Search information |
| Request: 547580 | Match: SGN-E547580 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C194712 | Clone name: TUS-71-I14 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C104787 [cLPP-16-A22] | Trace: SGN-T176344 | EST: SGN-E363962 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C194712 [TUS-71-I14] | Trace: SGN-T350434 | EST: SGN-E549559 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E547580 | Length: 225 bp (945 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E547580 [] (trimmed)
AATTTAAACAAGCAAAAGCTACCAAAATCTATTGGCATAATCTTTATACATATTATCTATATTCAACAATAGAGTAAAATAAATTTAGCCAACTG
AAATGCAAAAAAAAAAAATAAAAAAAAAATGAAGGTTTCTACAAGACATATTATACAAAACTGGTCTCAACCAGATGTGAAAAATGGTTACTAAA
TGTCATACATACATACCAAGATCAAAAGAATATTT
AAATGCAAAAAAAAAAAATAAAAAAAAAATGAAGGTTTCTACAAGACATATTATACAAAACTGGTCTCAACCAGATGTGAAAAATGGTTACTAAA
TGTCATACATACATACCAAGATCAAAAGAATATTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E547580] | SGN-U573344 | Tomato 200607 | Build 2 | 11 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T348455 [Download][View] | Facility Assigned ID: TUS71I14_P1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.836 | Expected Error Rate: 0.0026 | Quality Trim Threshold: 14.5 |
Working
