EST details — SGN-E547870

Search information 
Request: 547870Match: SGN-E547870
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194881Clone name: TUS-71-P15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U584699 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C109788 [cLPT-1-A21] Trace: SGN-T177732 EST: SGN-E366307 Direction: 5' Facility: TIGR
Clone: SGN-C109788 [cLPT-1-A21] Trace: SGN-T177733 EST: SGN-E366308 Direction: 3' Facility: TIGR
Clone: SGN-C194881 [TUS-71-P15] Trace: SGN-T348746 EST: SGN-E547871 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547870Length: 789 bp (922 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E547870 [] (trimmed) GTGCATCAATAGTGTTTGGATTTCCTTTATATGAATAAGTATACAAGTTGAAGCAGACACAAGTGTATTAAACGTATCTGCATCTTATTGCTGCA
TTTACTCTTTATCTTTTAATTATTCTGTAATGATTATAATTGTATGTGCTATGTGGTCCTACAAAACTAGTATAGAAGGTTTGTTTACAGCATCC
GCGTGGAAGTGGAAACACTCGGAATGACTGAAAATTTTAACACGGGTAGGTTCCTGTAAGCCGGATGTGATCAAGTGTCGTCTTAAGGCCATACT
TGAGCACTGCCTTGTTACCTTCTCTGAATCCATCCCCATAAGCTGCTGATGTATCTGATTCAATTTGGTGCTTAAAAAAATCACCCAGTTTCTTC
TCAAAGTCGGAGCGTTTCCCTTTCTTTGATGAAGTAGATGGTGATGAAGATGATGATGAGGATGCAGAGGTAGATGCAGAAGTTGAAGTACTGCC
AGAACCAGCTATAATTTCTGAGTCCAACCACATGTGAGCTAAAACTTGGCAGATACCTTCTTCCACTTCTGGACTTAAACTCGGATAACCTTTAA
GCCGTAACCATGCATGCATCATTTCATGAGCCAGAATTGAACCAGTCAATAACCTAGGAAGACCATACAAGATTAGAATAGCTGTCACTTCACAG
TGTCGAATTAACCTGTAAGGCTCTGTAAACATATCTAAAATCCGATAACCACCTATCCGTGGTCTCCTTGAAATACTGCTAATGGTCTGTTCCTC
GGACAGGCAGAGTCCTCGAGTCTCAGGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547870] SGN-U584699 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348745 [Download][View] Facility Assigned ID: TUS71P15_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5