EST details — SGN-E547921

Search information 
Request: 547921Match: SGN-E547921
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188867Clone name: TUS-56-F1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C48688 [cLEI-5-H6] Trace: SGN-T80678 EST: SGN-E266706 Direction: 5' Facility: TIGR
Clone: SGN-C188867 [TUS-56-F1] Trace: SGN-T338494 EST: SGN-E537619 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547921Length: 528 bp (868 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E547921 [] (trimmed) AACCCAAAAGCACTTCCGCAGCATCTCCACTTGCATATTTTGGGTAACTGTTTTTACATTCACAGGGGATTGAAAGAATTTTGACGGATTATAAA
AAATTGTATCCCCCACAAAGAATAATAGGGGATAAATCTATGCGGGACTAATGGTAATAACTCAGCTGGGACAAATGTTTTCTACAGTATGCCAC
CAAAACTCGTTCACCACTCAAAACAGACAGATAGTCCCTTCATCGTTCGTCCCATTCAGACAACAACTTTGAGAACCATAAGAACGGATTACATA
CAGCTGGAACCAACTGTCTTCACTGAACCTAGTTGGGGGGGGTAAGCACAGCTACAAAATTAGGATTTTCACACCGGCCCAACCAATTGCTTTTA
GGGTGACGGGTTTCCTTCAGTATTCGGACCCCACTCTTCTTCAGCCTCATTTCCATTGACGAGTACTGCACTATCAGTAGATTCAGCATCTACAA
CAGCCTCTTCTTGGGTCTCCTGGTGGAGTGCCATCTTGTCCCTGCTCTTGCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547921] SGN-U587612 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348796 [Download][View] Facility Assigned ID: TUS56F01_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0200 Quality Trim Threshold: 14.5