EST details — SGN-E548277

Search information 
Request: 548277Match: SGN-E548277
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190176Clone name: TUS-59-L14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77839 [cLES-3-H12] Trace: SGN-T97588 EST: SGN-E284567 Direction: 5' Facility: TIGR
Clone: SGN-C190176 [TUS-59-L14] Trace: SGN-T340660 EST: SGN-E539785 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548277Length: 761 bp (881 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548277 [] (trimmed) AAAAAAAATTAATCTTTGTTTCCTGTATAAAATCATATATCAGTACAATCTCATTATTCACTTATCTAAGCTTTAGAAGTTTAGTCCAAATTCGA
AGTTTAAACTAGCTTCAACAACATTGACAGGAATGCAAGTAACATGAAATTCGATAAAAGGCATAAATACTTCAATTACAAATCAAGTTTACAAA
ATATTAGCTACTATGAAATTTTATCCTCTTCTTATACACTGAGTTTGTCCATTTCCCTTCTTAGTGCATTAGCCCTCACCAAACTTCCAATGGTA
TTCACAGCAAGCTTCAAGTCTTCAATGGGGTTTCCTGGTGCAACTTTCTTGTACAAATAGCTGTCGAATGTCATCTTCTGCACATACTCATCAGC
GCACATCTCCACGAAAGCTTCTCTTGCTGGATTCGACCTGTAAAATACCTTCTGCAAGATATCAAGCACCTTGTATGTTGGCCAGTAAGTCTTGT
CCCATTTCTCCAAGTACTTCCTCAAATCACTCTCGTCCACCATTCTCTTCCCATTTTCTGATCCTTCAACAATTGCTTCAGCACACATACGTCCA
CTCTTCGCCGCGAAGTAGATCCCTTCGCCTGAACATTTCGTCACGTATCCTGCTGCATCCCCAACTAATGCGACTCTGTCTTGTAATCTTCTTGG
CCTTGGGTGTTCTGGAATTGGATGAGCCTCAACTCGGATGATTTTTCCGCCGGTGATTTTGGAATCGGCTCTCAGATTCCCCTCAACATTTTCCT
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548277] SGN-U564570 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349152 [Download][View] Facility Assigned ID: TUS59L14_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5