EST details — SGN-E548437

Search information 
Request: 548437Match: SGN-E548437
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190742Clone name: TUS-61-D4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C88243 [cLET-7-I23] Trace: SGN-T104049 EST: SGN-E291796 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548437Length: 776 bp (887 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548437 [] (trimmed) GTGAACTTCCATATTGTACTGCTTTTTTTTTCTTCATTACCGTGAGGTAGGGGTAAAGTCCACGTAAATACATGACTTGCCTATTCACCTGATGC
AAGCACAATATAATGTGCTAAAATCTACACAAGCACATACATATCATAAGAAAACAAGTTCTGTTCTATTTTTACAAATCTGTTGCAAGACTGAC
TACACAACTGCCCAAATATTCTAAAATTCTAGTGATTCCATGTCCAAAAGTTGCTCTGAATTGTGTTTCTATGTATCCGTCTCAACGCGTTGAAG
AACTTCCTCTTTGACTATGATTGATTGTCTTCATCTTTGATGGGAGTAAAAATGCAAATCACAGCTCTCTATTAGCATTTACAAGCTTCAGTAAC
TTAGCCAGATCATAAGACTTGAAATCTTTGCCATAACAAAGGCTAATATCAAGGGGTGTTTTACCATCCTTATTCTTTCTGTACTTATCTGCTCC
ATTGACAAGAAGAACTTTTGCTATGTCTCTGTTTCTGCTTTGCATGGCCACGTGCAGTGGCGTCCAACCAACATTATCAGCAGCATTCACGTCAA
CCTTGTATTTGATTAACATTTTAACCGTTTGCAAGGCTCCTACTTGAACTGCATAATGTAGAGGGGTGACACCATCCGTATCCCTGACTTGAGGG
TTTGCACCTTTTCTTAGAAGATGACTGATCACAGCCTCTTTTTTACCAAAACGGCATGGTGAAGAGCTGTTTGCCCCTTCTTGTCAACGGCATCC
ATATCAAGACCCTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548437] SGN-U594747 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349312 [Download][View] Facility Assigned ID: TUS61D04_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0014 Quality Trim Threshold: 20.5