EST details — SGN-E548469

Search information 
Request: 548469Match: SGN-E548469
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190856Clone name: TUS-61-H22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80794 [cLET-13-G4] Trace: SGN-T105762 EST: SGN-E293919 Direction: 5' Facility: TIGR
Clone: SGN-C190856 [TUS-61-H22] Trace: SGN-T341828 EST: SGN-E540953 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548469Length: 761 bp (931 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548469 [] (trimmed) AGTATTAAAACAAATGCCATTAATTCAAAAGATGAAGGGAACACAACAAAGTAAAATTACTACAGTTTCTCCAGAGAAAAACTTTAAGGAGGATT
CAAACAAGCTTCCCCTAAATACATAGGGTCAGTTATACATTACATAATTAAAAATTGGCATTTTAGTATCCTTCGGGCTTGTAAGCGATGAAACT
GATGCACTGCACTTGACGAACATTGTCGAATCCGATGATACGGACCCATGCCTGAGGGTAAGCCTTCTTTGCCTCCTGCACCTCAGCCAAGACCT
GGGTTGCATCAGTGCACCCAAACATGGGCAACTTCCACATGGTCCAGTATCTGCCATCGTAGTATCCTGGTGACTTATGGTTCTCACGGTACACA
AATCCGTGCTCAGTCTCGAATTCCAAGCAAGGAACCCATCCATTTTTCAATAGGTACTCAATTTCGCTGAGCAATTGCTCGTCGGACAAATCAGG
AAGGTACGACAGAGTCTCGTACTTCTTCATGTTAATTGGTGGCCACACCTGCATGCAACTGACTCTTCCACCGTTGCTAGCAATGGAGGTAATGT
CAAGGTTTTGCTTCCTTGAAACAGGGAAAGAAGCAGTGGACTTGAGTCCAGTGAAGGGTGCAACCAGTCTGATTCTGTCAATGAATCTGATTGAG
GTGGTCCTTAGTCCCTTTACATGTGCAGCAGTAATTTAAATGAAAGAAGATAGGCCCTACTAACCAACAGAAAGCATTAATAAAGTTAAATATGC
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548469] SGN-U578438 Tomato 200607 Build 2 819 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349344 [Download][View] Facility Assigned ID: TUS61H22_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5