EST details — SGN-E548471

Search information 
Request: 548471Match: SGN-E548471
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190863Clone name: TUS-61-I5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81005 [cLET-14-B16] Trace: SGN-T106289 EST: SGN-E294446 Direction: 5' Facility: TIGR
Clone: SGN-C81005 [cLET-14-B16] Trace: SGN-T106290 EST: SGN-E294447 Direction: 3' Facility: TIGR
Clone: SGN-C190863 [TUS-61-I5] Trace: SGN-T341840 EST: SGN-E540965 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548471Length: 423 bp (904 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548471 [] (trimmed) AACGGAAACAGTAGAACTACTTGTTCCCTTGTTTTCTGAATTTCATTTCAAATTGAATGATATTGAGTTTACAAGATGAGGCATCTAACCTAGAT
GAGGCATCCTAAGATTTTCAATATTGGGGAACTTCATTTCTCCATGCTACTATGACTACATGTGTTATCATCATTCATCTTGAGCAATTCAAACA
AATGATGGACTTGTGGCCCTTTACAAAAGAGGAACTCAAATGTGTTGTATCACTATATACATTGCAACAGCACATAACAATGGCCAATTCTCTGC
AGCTCTCATCTTCTACAGCATCAAGTATATTTGACAAACAACCGGCAAAACTTACCCAACGTGATGTGCTGATCATCGCACTCCTCTAGCAATTG
ATTAAACCTATGCATGAGGAGAGGAGCCATGTATAACCCCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548471] SGN-U569725 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349346 [Download][View] Facility Assigned ID: TUS61I05_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5