EST details — SGN-E548674

Search information 
Request: 548674Match: SGN-E548674
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191580Clone name: TUS-63-G2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C89176 [cLEW-11-P6] Trace: SGN-T112879 EST: SGN-E300039 Direction: 5' Facility: TIGR
Clone: SGN-C191580 [TUS-63-G2] Trace: SGN-T343069 EST: SGN-E542194 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548674Length: 693 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E548674 [] (trimmed) AAGAAGGGTGCTTTTGCTTTTCTCGAGGTTTGGGATTGAAGAGGCAGCGTAGCGAAAATGGGAGCTGGTGGTCGTATGTCTGCTCCAAATGGCGG
GACTGAAGTAAAGAAGAATCCTCTTCAAAAGGTACCAACCTCGAAGCCCCCTTTCACAGTTGGTGATATTAAGAAGGCTATCCCACCTCACTGCT
TTCAAAGGTCTCTCATCCGCTCATTTTCATATGTTGTGTATGACCTCATACTCGTATCCATCATGTACTACGTTGCAAACACTTACTTCCACCTC
ATTCCATCACCATATTGCTACATTGCATGGCCTATTTACTGGATTTGCCAGGGTTGTGTTTGCACTGGAATTTGGGTTAATGCCCACGAATGTGG
CCATCACGCCTTCAGTGATTACCAATTGGTTGATGACACCGTAGGACTTATCCTTCACTCTGCTCTATTGGTGCCGTACTTCTCTTGGAAATATA
GTCATCGTCGCCACCACTCCAACACTGGCTCCCTCGAGCGTGATGAAGTCTTTGTGCCTAAGTCTAAATCCCAGCTCGGATGGTATTCCAAGTAC
TTGAACAATCCACTAGGCAGAGTTATCACACTCACAGTCACCCTCACTCTTGGTTGGGCGTTGTACTTGGCATTTCATGTATCTGGCAGACCTTA
TGACCGATTTGCATGTCACTATGACCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548674] SGN-U577227 Tomato 200607 Build 2 126 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349549 [Download][View] Facility Assigned ID: TUS63G02_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5