EST details — SGN-E548737

Search information 
Request: 548737Match: SGN-E548737
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191805Clone name: TUS-63-P11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90443 [cLEW-22-J12] Trace: SGN-T114107 EST: SGN-E301209 Direction: 5' Facility: TIGR
Clone: SGN-C191805 [TUS-63-P11] Trace: SGN-T343458 EST: SGN-E542583 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548737Length: 522 bp (872 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548737 [] (trimmed) GGAAAAAACCCCCCCCCCCCCCCATTTTTTGGGAATTAACCCCCCCCCCCCAATAAAAAAAAAAAACCCCCTTTTTTAAAAAAAAAAAAACCCCC
AGGGGGTCCCCCCAAAAAAATTTTTTTGGGGCCCGGGGGAAACCCCCTATTAACCCCCCTTTTGGGGGGGAAAAAAAAAGGAACTTTGGGGGGCC
CCGAGCCAAAAAAGAACCCCCCCCGGGCCAAATTCCCCGGGTTAAGGGTGGGAAAAACCCTCCCCAAAATTTTTAAAGGGTGGAAAAAAAAAAAA
CCCCGGGGAAAAACCCCGAAAAAACCCGGGGAAACCGGGATTTTCCCCAAAAACCCCTTGAAAACCAAATTTAAAAATGAAAAAAACCTTTGGGG
GGAATTAACCCCCAAAAGTGCCCCCCAAATTCCCTTTTTCCCCGGGGTTTTTCAAAAGGGGGCCCCCCCCTTGGGGGATTTTCCCCCCACGCCCG
GGTTAAAACACCCCCGGGGGGGGGAAGGGGGGCCCCCCCCCCCCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548737] SGN-U602599 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349612 [Download][View] Facility Assigned ID: TUS63P11_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.426 Expected Error Rate: 0.0133 Quality Trim Threshold: 20.5