Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E548802

Search information 
Request: 548802Match: SGN-E548802
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192032Clone name: TUS-64-I22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C91396 [cLEW-27-E24] Trace: SGN-T114939 EST: SGN-E302356 Direction: 5' Facility: TIGR
Clone: SGN-C192032 [TUS-64-I22] Trace: SGN-T343852 EST: SGN-E542977 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548802Length: 764 bp (908 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548802 [] (trimmed) CACCAAAAGGGTTCAACATCTACGGTATATTATATATACATAAAGGTTTTAATCTTGCATATGAAATGCTAAAGCTCCATTTACACATGGACAAA
AAAAAAAAGTAGTACATATGATTGAGGGCCTTGTACAAAATGATACATATCAAGAACTGTTTCTGGTTTTCACCCTTCCAATATAACCCCCTGAC
TCTCTAATATGAAAATCGAAATTACAAGCTCGGAGCTGATCATCATAAAATACATAGTTTAACTATTTTGACTACTAATCAAGGCTAATAACAGT
GAATTTCGTACCGTTTTGTATTTCTACAGGGGTTTCAAGGTCTGAGGTTAAACAAAAATTTTTGGATGATACAAGTTTTGATTCAACTCTGTGTA
ACCTCTTGAAGCATTTCTATCACCTTCTTCATTCTTGGTCGTTTTGCTGGAATGGTATCGGTGCACATCAATGCGACTTTTAAAGTTGCAAGCAT
TTCTTTCCTCCAAGCAAAAAAAATGGGGCTAAGTCTTGCATCAAGTATCTGCTCTGGGGTTTCCCCCCTGGCAAATGCACCATGAACCCACCTGA
CCAGATCAACTCCTTCACCAAAAGCTTCATCAACGGGTAGTCGGGTGGTAAGGATCTCAAGCAAAACAACGCCATAGCTATAAACATTTCCGGGA
GCTGTTACTTGCATTGGATATGCATACTCTGGGGGAATGTATCCAAATGAACCAGCAACAGCACTAATACTTGCGGTCCCTCTAGATGGATCAAA
AAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548802] SGN-U568120 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349677 [Download][View] Facility Assigned ID: TUS64I22_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0136 Quality Trim Threshold: 14.5