EST details — SGN-E549028

Search information 
Request: 549028Match: SGN-E549028
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192832Clone name: TUS-66-K6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C95873 [cLEY-13-J9] Trace: SGN-T119391 EST: SGN-E306213 Direction: 5' Facility: TIGR
Clone: SGN-C192832 [TUS-66-K6] Trace: SGN-T345226 EST: SGN-E544351 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549028Length: 575 bp (912 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549028 [] (trimmed) AATCCAATAGAGCTTTATACTCGTGAGCCCACAAAACTTTTTTTGTCCCAAAGGGAACAAAGGTCACGCGCGCGACGATTACAGCTTGTCCTCGT
AGTCGTTGAGGTCGGGGAGGGCATCCTTGAGACCCTTGCGCTTACGAGCGGCCATGACAATCTCGTAAGCCTTGGTGCCCTTCTCGAAGGGATCG
GTGCTCAGGACCTGCCAGTGGTCGAACACGCACTGAGGGAAGGCCTGGCCGGCGGTGTTGGCGCGGAGATCGGCAGTGAAGCCGAAAGACTCGTT
CACAGGCAGGTAAGCCTTGACGTTGTAGAGAGGAGTGCCGGGGCGAGGCTCCTCAGCGATGACGTGACCACGGCGGCGGTTGAGCACACCGTAGA
TGCCACCGACAGCGCGCTCGGGGCACTGGATCTCGACGAGGTAGACGGGCTCCATGAGGCGGGGAGCGGCGGTGATCTCGGCGGCGTATATGGCG
CGACCGCAGGTGGGGATGATCTGACCGCCACCACGGTGGACGGCATCGGCGTGCAGGGTCACGTCGACGACGTTGAAGCGGATGCCCCGCATGTT
CTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549028] SGN-U599113 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349903 [Download][View] Facility Assigned ID: TUS66K06_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0051 Quality Trim Threshold: 20.5