EST details — SGN-E549313

Search information 
Request: 549313Match: SGN-E549313
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193841Clone name: TUS-69-E7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C101327 [cLHT-17-N11] Trace: SGN-T170828 EST: SGN-E357163 Direction: 5' Facility: TIGR
Clone: SGN-C193841 [TUS-69-E7] Trace: SGN-T346959 EST: SGN-E546084 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549313Length: 799 bp (893 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E549313 [] (trimmed) GTAAAAACAAGAAGGTGGAGATACTGGAGGCGTGAACTCTAATCTGTATCCTACGGGGCTAAAAAATGGCAGGTGAACCAGTTGATGTGAATGAA
TTTGAAGAGCTAGCTAGGCAAGTTCTTCCAAAGATATCCTATGACTTCTTTTCTGGAGGAGCTGAGGACCAGCACACACTCAAAGAAAATATTGA
AGCATTTCATAGAATCATAATCCAGCCAAGAATACTTGTTGATGTGAGCAGAATAGACATGTCAACTGTTATACTCAGTCACAAGACGTCAGCTC
CTATAATGATTGCCCCAACTATGATGCACAAATTTGCACACCCTGAAGGTTGTACTAAATCAATTACTCCATTCATTTCAATTTGTTTGTGTGGT
TTTGACTTGACACAACATTTAAGAAAGTAAAGAAGATTTTTGTGTCTTATTATCTTAAACTAAAGATATGTAGAATGTACCAAAAGATGTTTAAC
CTTGTGCTTTTAAACATGTCACGTGCAAAGATAGACTTAAAGACTTCTCAAATAAGAAAAGAGGAACCGACTAAAAAGGAAAGTAAGAGAAACAA
ATTGGAACGGAGAATATCTCCTTGGTCACTTATGGTTAACTGATTCTACAAACCTGTTATATTTATGCCAGGAGAAATTGCAACAGCTAGAGGTG
CTGCATCGTGTAATGTTATCGCGGTAATATTTTCTGGAAAAAAAAGACAGATTTTATCGAATTCTGGTGTCTGGATGCTAAATTCTCTTGGATAC
CGGGATTGTCATTTACGTTTAAGGCTGTTCGCTTCATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549313] SGN-U573112 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350188 [Download][View] Facility Assigned ID: TUS69E07_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5