EST details — SGN-E549364

Search information 
Request: 549364Match: SGN-E549364
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194022Clone name: TUS-69-L20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C102266 [cLHT-24-E22] Trace: SGN-T170466 EST: SGN-E358906 Direction: 5' Facility: TIGR
Clone: SGN-C194022 [TUS-69-L20] Trace: SGN-T347270 EST: SGN-E546395 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549364Length: 688 bp (942 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549364 [] (trimmed) GAGGGGTGAATTAACTGTTGTATTTATTGAGAACAACATATTACATTGATCATTAACATAGTTACACATTCCATTTTCCAACAAAAAATAATTAC
TATACTAAACTATACACATCACCGGCCTCTTCCTCAATTACCGCCGCCGGCCGGCATGCTCTGTTCTGTAAATTAATTATTTCTTAGTAACACAA
CAATGAAATATAATACACTAAACAAGATTACTAATTACTTAATTAAGCCAGTGTTCATCAAAAACTGGCTCTTCTCAGAGAAGTTAAGGTAATTG
CAGCTCCTAATGGAGATGCACCGACTTCAATCTCAAACGAATCATATCGGAGGAACAATTCGACCAACAACAATCTTGAAACCAGTACGACGAAG
TCTTTTCCGGCACACTGTTTGTTATTTATCGATGGGTTCTCTGTTTCCGACCCATTTGACCATAACACGTGTTTCAACAGCTTCTCCCCTTCTTC
TCCGATGAACCGATCGGCGACGAATTCTTCCGATCGATCGAAGATTTTTGGGTCTTTAGTTGCAAACGGTTGAAACCCATAAAGGAGTTCACCTT
CTTTGATCTCGAACGATGCGTCATGGGATTCAATTACCATGTCGTGTTTTGCTCTGCCGTATTGTGATGCTACCGGAGGGTTCAATTCTGAGGGA
TTCGTAGACTACTGATTTCATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549364] SGN-U576466 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350239 [Download][View] Facility Assigned ID: TUS69L20_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5