EST details — SGN-E549573

Search information 
Request: 549573Match: SGN-E549573
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194762Clone name: TUS-71-K16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C105111 [cLPP-17-B23] Trace: SGN-T176861 EST: SGN-E365149 Direction: 5' Facility: TIGR
Clone: SGN-C194762 [TUS-71-K16] Trace: SGN-T348541 EST: SGN-E547666 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549573Length: 1819 bp (untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E549573 [] (untrimmed)
NCCCCCCCGCCGCCNCCGCCGGCGCCCGCGCGTCCGCGAGGCCGCCGCCCGCACTGCTNCGGGGTGCCCGCCGAGACCGGNNNCACGGCGGGAGG
AAAGGAGTGGTGGGAGGTTCATTCCGTCAGGGTGAGCGGGGGCGCGGCGTCCTTGGCAGGCTACGTGGAAGATCCACTCCTCGTGGTCATCCGCT
GGTAAAGATTGACCAGTCTACCGCAGGATGGTTCCTGTAGTGTGTTTCGCGTTGCTGCTCGTCTTCTCTCTATAACTTACCTATGCCCCGAGCTA
GCCGACGCTCAGCTAGATCCTCTGCTAGTCCGGTCGTTCACCCGNCGTGGTGTGTGCGTCGCGACGCCACNTATATTTATTTTGTGACCGCACTG
CCNCGGCCTCGCAGTGCCGCCGAGTCGCGCGAGCAGTCTCGAGCCTAGTATCATTACATACTCAGTAAGGGGGTTATTGTATNTATGGCTGCATC
AGCATACTGTCCCTAGTCCGTGAGAGAGACACGTCGACCCGGGCTGCTACGTTCGCGTACTCTGTACTCGTGTCGGTCGTGATATGTTGGGGCGT
GTGGGTTGGAGCGGTAGTACTGTGGTGACGGCACATGAGGTAGTCGAATGTGGAGGTGTGATAGAGNCTGGGCGGCCGCGGGCGTGTGGCACCCA
CGCCTATCGGACATGTGATTGTCTACTCTCTAGTCCGCTGGCTGCCTCCCATGACAGTTGAGCGAGTGCGCTGGATGATGTATCGTATTTGGATG
TGTATACGACGACAATCATATGGCTCGTCTCTCTCGNCGCGTCCGGCCGATGTGTGCTGGTGATCTGTCTATGATCGTGATGTGGGTGCTAGGTA
CTCCGTATTCTTATACGCATTCATGTCTTTTTTCTGTGCGCTCTCCTATCGACCGTGGTGNGGTGTCGCGAGGTGACTCAATGGAGGTTAGGTAC
TGCGCAGCGTGGCTGTCATGGCCGCGTATCTCCACAATGACGAGGCGAGGAATAGCTTCCATCGCGTGCCGCAGTGAAGTGTCCAATTCAGGGNC
AGAGGTGTGACTGGCCTCAGACATGAGCCGAACTTGCACTGCTCACTCCGCGCCCATGCACGTCGCTGCGCACCCGTGCTGCTCGTGGTCCTTCA
CTGCGGGCTACGTGTGGAGCATGCGGGTGTGCGGTCATCGATGTAGGGCGTGAGACGGTCAATGTTCGCTACGATCTCCTCTGCCGCAGGTTGCT
CATAGAGGTTACATGTACGCGTACAGGCGCTGCCGTGCGCTACGCAGCTAGGTGTGTTCTCGCGCGCGCGCTGTGGACGCATGCCCGCGCGCCCT
CCCACCTCTCTGTAAACGCNACGAACGCGTCGGCGCGCGGCCTTGCGCGGTGAGCAGAGCGTACGTCGCGGCGNGCGGCGGCGCCTGATCTGATT
CAGGCCATGATTACCTGGGCATATATCATATACGCATCTCTGCCAGACAACACGGTGGAGCAGTCACGCAAACGAAAGAGACAGATCGCCAACTC
GCGTTGTGTTAGGTTTTGTGTGCCGGATAATGCTCGCATGTCATCTGCGACGGTATCTCATCCTGAACATCGACGACTCGGGGCGACAGTCTCTC
CTACTCCGATATNCGTGATCTACTCTCGCGCGCATCTGATGCTCTTGATATGANAGCGCGATACACAGTCGCCGAGCGGGCTGTGCTGGCGNAAT
CGCCCTCTCGCCGCGCGACGTGTAGAGCGCGGGTCACGGACACTGTCGCGNGTACATGCGACCCTACAGTCATGAGCGGTGCGGTGGAGATCAGC
ATGATGTGGGGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T350448 [Download][View] Facility Assigned ID: TUS71K16_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Problems: High expected error (low overall quality)
Sequence Entropy: 0.000 Expected Error Rate: 0.1006 Quality Trim Threshold: 20.5