EST details — SGN-E550718

Search information 
Request: 550718Match: SGN-E550718
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186542Clone name: TUS-50-E4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3066 [cLEC-19-D3] Trace: SGN-T27488 EST: SGN-E202647 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550718Length: 593 bp (739 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550718 [] (trimmed) CTACGAAATCTGATCTTTCTCATATATACCGATTGTTTTACCAAATCCATGAATACCATAACTATACTCATCTATACAAAGCTACTGAGTCCTCC
TTGGCCAACTTGCTCTTTAAGGAAAACCCTCTTCCACTTTTCTACGGTCCATCAGTACTTCTACTTGAAGTCTCTCCAACCCCTTTTAAAGAAGC
TAAGAATGAAGAGTTCAACCCTGTCCTTACAACGTTTGACCTTAAATTCCCTGTCGTAGAAGGACAGGTTGAGGAATTCCGGTCCAAATATGACG
ATAAGAGTGATGCTTACATCGCGGGATATGCTTTCTTTTACGCGAATTATTCGTGCTTCTATGACAAGCCTGGGTTCTATTTTGAGAGTCTTTAC
TTCAGGGAGAGTTATAGGAAGTTGGGAATGGGGAAATTGTTGTTTGGGACAGTTGCATCTATTGCTGCTAACAATGGGTTTGTATCGGTTGAGGG
AATAATCGCAGTATGGAATAAGAAGTCATATGATTTTTACATAAATATGGGAGTTGAAATTTTTGATGAGTTTAGGTATGGCAAATTGCATGGTG
AAAATCTTCACAAGTATGCTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550718] SGN-U579171 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351593 [Download] [View] Facility Assigned ID: TUS50E4_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5