EST details — SGN-E550964

Search information 
Request: 550964Match: SGN-E550964
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188209Clone name: TUS-54-J15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C36056 [cLEG-37-G3] Trace: SGN-T70556 EST: SGN-E256072 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550964Length: 476 bp (663 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550964 [] (trimmed) GGGTGTTAAGTCTCGGAAATTCGTCTTGGCTTCCAAGAGGATTCAGAAGGAATTGAAGGACTTGCATAAAGACCCCCCTGCTTCCTGCCGTGCAA
GCCCTGTATGTCAGGATATGTTCCATTGGCAAGCTACCATACTGGGTCCATCTGACCGTCTGTTTTCTGGGGGTGTTTTCCTTGCATCTATCCGT
TTCCCTCCAGATTATCCTTTCAAGCCCCCGAAGGTCTCTTTCTTAACCAAGGTTTTCCACCCAAACATCAACAGTAATGGTAGTATTTGTCTTGA
TATCCTAAAGGAACAATGGAGCCCTGCTCTTACTGTATCCAAGGTGCTGCTTTCTATTTGCTCTTTGCTTACTGATCCCAATCCAGATGATCCTT
TAGTGCCAGAGATTGCTCACATGTACAAGACGGATAGACCCAAGTATGAGAGTACTGCCAGATCATGGACCCCTAAATACGCCATGGGTTGAACA
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550964] SGN-U568401 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351839 [Download] [View] Facility Assigned ID: TUS54J15_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0204 Quality Trim Threshold: 20.5