Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E551290

Search information 
Request: 551290Match: SGN-E551290
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186633Clone name: TUS-50-H23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6220 [cLEC-34-L8] Trace: SGN-T30575 EST: SGN-E208131 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551290Length: 609 bp (745 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551290 [] (trimmed) AAGTCCATTCCTATTTTGCTCGTAACTCTTCTCGCTAATTGCATCGCTAATCTCCGTTCGATCATCTTCACTTTTCTTCAGTTCATCGGCGTTTC
AGTAAATCCGATTCAAATCGAAGAAAATGCGATTTACGATGCGGTTGGTTCAGGTTTAGCCGGAGTCGTTATGCTGGCTGAACAGCTTAATTTGA
ATCGGATGTTCTCGTATGCATTTGACGATCAATCTGCTGGTTCGAGCTGCGTTTTTTGCTTGAATCGATTAATTGATGGTGAAAATGTGAGGAAA
TTGGATTGTAAGCATGTTTTTCATAAGGCGTGTTTTGATGGATGGTTAGATACGTTTAATTTTAACTGTCCGATTTGCCGGTCGTCGTTATCGGT
CGTTTCCGATGAGCGCGTGGAGGTCACGCGACGGCGCGTTGCATGGGATGTGATTGAGTGGTTCTCGTTGAGGTGAAATTATGCGAATCAGAACT
TCGATAAACGAGAGGCATAAAAACTTCGATAAACGATTGGCATAAGTATCACGAGGTGTGAAGGAGATCAACTAATACAATCTGTGTGTTGGTGA
AAATGAGTGATGAATTTCACCAGGAGTTCTTTGTTTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551290] SGN-U579034 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352165 [Download] [View] Facility Assigned ID: TUS50H23_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5