EST details — SGN-E551299

Search information 
Request: 551299Match: SGN-E551299
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186727Clone name: TUS-50-L21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C9048 [cLEC-54-F6] Trace: SGN-T32974 EST: SGN-E209665 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551299Length: 627 bp (772 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551299 [] (trimmed) GTGAGATTGATGCAATCAGAATTCAGAAGTCGTTAAACGGATTTCCACTTATCAAATTTGTGTTGTTCCTATGGCTGTTTTCAGTCCCACTTGTT
CTTCTACTTCCCCACTTCTCTCCTTCAGAAACAACATCTCTTTCTTCCCTTCACATCGCCCTTCTTTTCCCGGAGTCCGGTGCACTCTCACAGTG
AAAGCCACCGTCAGCGTCGAATCTCCGTCGTCTTCCTCCACCGACTGCAGGGATGACTCGCCCAAGGTCTTACTTGAAGTCCGGGACCTCTCCGC
TGTCATAGTCGAGTCAAAGCAGCAAATTCTCAATGGTGTTAACCTCACTGTCCGCCAAGGCGAGGTACATGCTGTAATGGGTAAGAATGGTTCTG
GAAAGAGCACCTTTGCCAAGGTTCTTGTTGGGCATCCAGATTATGAAATTACAGGAGGCAGTGTGTCATTTAAAGGTGAGAATCTACTTGAGATG
GAACCCGAGGAAAGATCTCTTGCTGGTCTTTTCATGAGCTTCCAGTCCCCAGTTGCCATACCTGGAGTAAGCAATATTGACTTTCTTAACATGGC
GTATAATGCTCAAAGGAGGAAACTTGGACTGCCAGAACTGGGACCAATTGAGTTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551299] SGN-U582143 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352174 [Download] [View] Facility Assigned ID: TUS50L21_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5