EST details — SGN-E551415

Search information 
Request: 551415Match: SGN-E551415
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186579Clone name: TUS-50-F17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C4424 [cLEC-25-H7] Trace: SGN-T28674 EST: SGN-E205258 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551415Length: 687 bp (784 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551415 [] (trimmed) TGGGGGTCTTTTAACACGCTTGAAACCCCCACAAAGCCCTTGTTGGGGCTTATTAAGGCATATAACACCACGGAACAAATTATGATAGTTCGGAC
ATGTGAAGAGGAGGTGTGCGGATGCACCGGTAGAGAGGTGTGAGAGGCTGACTATGACAACACACCGTTTCTGCGAAGAAGGTATGTAAGACAGA
GGTTTCCTAACAAACGATATTCTCCTTCTCTTGATTACTTGTTACTAACAGATTCAGTCAGCTTAGCTGTTTTGATAAGGCAATGCAGGTTGATA
GCAAGTTCAAGTGGATTGAGGAAATGATGAAGTGTACTCACTCCACATAAATCAAAGTTGGGGGTTGGTCAAACTACCAGAAGGGAATAAGACAA
TCCAGAATAATGTATGTACAGGATGAAACAGAAGCATAATAGTTCAATGAAATATAAAGCAAGGTTGGTAATAAAAGGTTTTCAACAAAAGGCAT
GTATCAATTTACTGAGATTTTCTCCCTTGTGATTAAATTACCTACTATTCGAGTTGCTTTAGAATTGCTGTAGCATAAGATTTATATTTAGAGCA
TTTAGATGTAAGGACAGCCTCTCTTTATGATGATCAACATGAAAGACGTGTATGCGTAGCAACCTGAAGTGTACATACAGGCTGATAAGAAAAAT
ATGGTGCGTAGACTGAAGAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551415] SGN-U580332 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352290 [Download] [View] Facility Assigned ID: TUS50F17_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0043 Quality Trim Threshold: 20.5