Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E551449

Search information 
Request: 551449Match: SGN-E551449
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188126Clone name: TUS-54-G4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C33308 [cLEG-26-E24] Trace: SGN-T68199 EST: SGN-E253276 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551449Length: 559 bp (670 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551449 [] (trimmed) AGATGCAGGACCCGCAGAAAATAGCTGCGGTCCGCAATCTCTCTTTTAGTCTGCAACGCGGTGAGACGCTGGCAATTGTTGGCGAATCCGGCTCC
GGTAAGTCAGTGACTGCGTTGGCATTGATGCGCCTGTTGGAACAGGCGGGCGGTTTAGTACAGTGCGATAAAATGCTGTTGCAGCGGCGCAGTCG
CGAAGTGATTGAACTTAGCGAGCAGAACGCTGCACAAATGCGCCATGTTCGCGGTGCGGATATGGCGATGATATTTCAGGAGCCGATGACATCGC
TGAACCCGGTATTTACTGTGGGTGAACAGATTGCCGAATCAATTCGTCTGCATCAGAACGCCAGTCGTGAAGAAGCGATGGTCGAGGCGAAGCGG
ATGCTGGATCAGGTACGCATTCCTGAGGCACAAACCATTCTTTCACGTTATCCGCATCAACTCTCTGGCGGGATGCGCCAGCGAGTGATGATTGC
GATGGCGCTGTCATGCCGCCCGGCGGTGCTGATTGCCGATGAGCCAACCACCGCGCTGGATGTCACTATTCAGGCGCAGATCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551449] SGN-U574289 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352324 [Download] [View] Facility Assigned ID: TUS54G4_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5