EST details — SGN-E553420

Search information 
Request: 553420Match: SGN-E553420
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C332033Clone name: cTSC-1-A8
nocartOrdering Not Available
Library Name: cTSCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E553420Length: 971 bp (1264 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E553420 [] (trimmed) GGCTTAATAGCTTTGTGTAGATAAGAGTGGTGGTTGAGCCATTTCTTCTTTTGGCTCCCTTGATTCCCTCAGGGATCTAGATATCTGTTTTTATC
GTTGGATGCTTTAACAGTGTAAAGCTTCATACCGTAAGGCTTGTTGATTGATGGGGTCTGAAGGGCCTCCTGCTGTAACCATCCATGTGACTGGT
TTTAAAAAATTTCATGGAGTTGCGGAGAATCCTACTGAGACAATTGTCAGTAATCTAAAAGAGTATGTGAAAAAAAGGGGTTTGCCCAAAGGGGT
AATCCTTGGCAGTTGCAGTATTCTTGAGACTGCAGGACAGGGAGCAGTTGTTCCTTTATATCAGACACTGCAATCTGCTATCAGCACAGCTAAGA
ACGAGTCATCCACTCCTGGTAGAGTTATTTGGGTCCATTTCGGAGTTAATAGTGGTGCAACAAAGTTTGCAATAGAGAATCAAGCAGTCAATGAA
GCTACATTTCGCTGCCCTGATGAGATGGGGTGGAAGCCTCAGAAAGTCCCTATTATCCCAGCAGATGGTGGAATTTCAAGAGCACGAGAGACTTC
TCTTCCTGTTGAAGAGATCACAAAGGCATTGGCAAAGATGGGCTATGAAGTGATGACCTCTGATGATGCTGGCCGATTTGTGTGCAACTATGTAT
ACTATCATTCCTTGCGTTTCGCAGAGCAGAATGGAATCAAATCTCTATTTGTACATGTGCCTCTCTTCTTTACTATAGATGAGGAGACACAAATG
CAATTTGCTGCTTCCTTATTGGAGGTACTTGCCTCTTTATCTTAGACTCTCACATTCTTGTCTCTCTTTTCATCTCGATCTGGTGGCATATTTGC
CTCGTCGTGGTCGTCGTGCATGTGACGATGGATGCAGATATCTCTGTGTCATGCTTCAATAAACTTTTAATTGTGTGTGGAATGGAAATGCGATT
TTTGCTGATGAATTAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E553420] SGN-U600411 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T355804 [Download] [View] Facility Assigned ID: ctsc1a8
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0063 Quality Trim Threshold: 12.5