EST details — SGN-E55395

Search information 
Request: 55395Match: SGN-E55395
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C31933Clone name: cLEG-16-E2
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180581 is on microarray TOM1: SGN-S1-1-6.4.19.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C31933 [cLEG-16-E2] Trace: SGN-T66853 EST: SGN-E252697 Direction: 5' Facility: TIGR
Clone: SGN-C180581 [TUS-34-L19] Trace: SGN-T187174 EST: SGN-E375272 Direction: 3' Facility: INRA
Clone: SGN-C180581 [TUS-34-L19] Trace: SGN-T187175 EST: SGN-E375273 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E55395Length: 540 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E55395 [] (called/trimmed by facility)
AATTAAAAATATTTATATTTAATCAAATTTTTAAAACAGTAAAGGGGGGCAAAATGGTAATACAACAATTCATTTTCGAACTTCCCCATATAATA
ATATATGAAATATGATAACAGACAAACAAATTTAGCATAAGGCAGTATTTAGCTTCAAAATAAGAGATCAAGCACGATCATCTTGTTGTTTAAAC
ATTATCCACTGAAGCAGGCGCTGCTGGTGTTGCTGGTGCATCTGAAGCTATGGTAAACTGTACACTTCTCGGCTGTCCAGAGTGTAACACAACTG
CAAATTGTGTTGCTGCCAATGCTGCAGCTTCCTCTCTTTGTCTGCGCTGCTGCAAGATGCTGATGGCCCATAGCATGATGTAGCAGGGTAAAAGA
AAGCCAACTGCCCGGAGTAAGAAAAGCGAAAAGAAAGCAGTTGGATCTTCATCATCTCCATCTGTATCTGTCATTGGTAATGCATGGCGCAATAG
TAGAAGAGCCATCAAAATTAAAGCAGCCGATCGAAAGAAAGCTGCACCACTTGCATTTGCAGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T66853 [Download] [View] Facility Assigned ID: TBFCJ25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence