EST details — SGN-E558317

Search information 
Request: 558317Match: SGN-E558317
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C335857Clone name: 17638
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E558317Length: 378 bp (947 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E558317 [] (trimmed) TAATCCCTTCACTTCACAGTCCAAAAAACCCATAAAAAATGGACCCCAAATCCACAAATTAATCTCCTTTTTTCGAATTTCTACTGGTAATAGCA
GTACTACTACTTCTTTACCCTTAAACAGATCAATTCATTACGATTCAGTGAAGAATACCCATCTCAATTCCAATCCCCAAAACCCAAAATTATCC
AGGAAGCTGAAAGAATCTGCAAAATCTTACTGAAAAACACCGATGTTGCTGATGCTTTGAGTTCCGCTTCAGTAAATGTGAGTCCTTTATTAGCT
AACGAAGTTATAAAGAAGCTCAGCAATTCTGGGATTTTAGCTTTATCTTTCTTCCGTTGGGCTGAGGAAGCAGAACGGGTTTGTTCATACTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E558317] SGN-U292689 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T359739 [Download][View] Facility Assigned ID: bf_swstxxxx_0018h09.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0009 Quality Trim Threshold: 20.5