EST details — SGN-E558492

Search information 
Request: 558492Match: SGN-E558492
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C336055Clone name: 17840
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E558492Length: 282 bp (800 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E558492 [] (trimmed) CTAAGGGTGAACATCAGACGGTCCCATTATCTGTGTTGTTGAAGCGTGAATTGGCCAATGAGAAGATTGAAAGTCCGGAGCTTTCTCATGGGTCA
AGCTAGTCAGAGCAAAAAAGGCGAAGATTTTACGTTTGTCAAGACAGAATGCCAAAGAGTTTTGGGTGATGGAGTAGCTACATATTCTGTTTTTG
GATTATTTGATGGGCACAATGGGTCAGCGGCGCTATATATTCTAAAGAAAATCTCTTGCAGAATGTCTTGAAGTGCTATTCCTCCTGATCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E558492] SGN-U295357 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T359940 [Download][View] Facility Assigned ID: bf_swstxxxx_0021a09.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0121 Quality Trim Threshold: 20.5