EST details — SGN-E564125

Search information 
Request: 564125Match: SGN-E564125
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C341669Clone name: 3539
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E564125Length: 541 bp (775 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E564125 [] (trimmed) CATGATGATGAACCAAATGTGAAGAGAATGAAGACAACAGTTGAGACTCCTATTCTTTCATCATCACATAAAGCAGAATCAGCAATCCAAGATTG
TTGTGCAGACAAGGGAGTGAAGTAGACATTTTGGATGACGGGTTCAAGTGGCGTAAATATGGGCAGAAAGTGGTGAAAGGGAATCATCATCCGAG
TCAGAGTTGGATTTGCAGGAGTTATTATCGTTGCACATACCCTGGGATGCAATGTTCGCAAACATGTTGAGAGAGCTTCAGCAGATCCAAAAGCT
GTCATAACAACGTATGAGGGCAAGCACAATCATGATATTCCCATTGCTAGAAACAGAAGCCATAGCACAGGCCCAAAATAGTAGTCGTCAGCTGA
ACGAGCAAGAGATTGCAACTTGGTAGGCCTTCACTTCTCGAAAAAGTTGCTCTTCATACCAATGAAATACCAGTGTGTAGGGCAGCTGAAAGAGG
AACATATTGCAGCATAATTTGCATTACTAAAAGGGAAAAGGGTGAATATTTATCTTTTGTCTATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E564125] SGN-U293386 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T365976 [Download][View] Facility Assigned ID: TBSK03190FB10.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0052 Quality Trim Threshold: 20.5