EST details — SGN-E564915

Search information 
Request: 564915Match: SGN-E564915
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C341294Clone name: 3164
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E564915Length: 249 bp (740 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E564915 [] (trimmed) GTCAAAGAAAAAATCAAAGCAGAATCAACGAAAGAAGAATGGCAAGGGAAATCATCCATGGAAACCTTGGGATCGTGAGAAGGATTTGACAGCGG
GAAGGCAAAATGTTAAGCTTGATGCTGCGGACATGTCTGAGGGTCTCACTTCCAGGTTTTCTTCTGGGATCCTTTCAAAGGAATTTCCTTTAAAG
AGTTGTGGTCATCTTCGATGTTTGAATTTGTATTGGCCCTCAACATATATATATTAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E564915] SGN-U291644 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T365601 [Download][View] Facility Assigned ID: TBSK02803FB07_T3M
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0164 Quality Trim Threshold: 20.5