EST details — SGN-E568455
| Search information |
| Request: 568455 | Match: SGN-E568455 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C345776 | Clone name: 12741 |
| ||
| Library Name: STOL | Organism: Solanum tuberosum |
Tissue: Stolon
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E568455 | Length: 184 bp (859 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E568455 [] (trimmed)
AGCTATGGACCCGGATGACGTTGAATCAACTGAAGCAATTCGTCGACACAGTGCCAAATCCAATCCGTTCCATTCTCGCCGATCCTTCTCTTTCA
TTTCTTCCGTGACTACATTGAGAATCTCGGTGCTAAAGTTCCTCCGGCTGCTTACGACACCGGCGATTACAAAGAGAAGTCTCATGCGG
TTTCTTCCGTGACTACATTGAGAATCTCGGTGCTAAAGTTCCTCCGGCTGCTTACGACACCGGCGATTACAAAGAGAAGTCTCATGCGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E568455] | SGN-U269474 | Solanum tuberosum | Build 4 | 28 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T369547 [Download][View] | Facility Assigned ID: bf_stolxxxx_0020e11.t3m |
| Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.965 | Expected Error Rate: 0.0281 | Quality Trim Threshold: 20.5 |
Working
