EST details — SGN-E5766

Search information 
Request: 5766Match: SGN-E5766
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C110049Clone name: cLPT-2-D17
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C110049 [cLPT-2-D17] Trace: SGN-T177935 EST: SGN-E365329 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E5766Length: 562 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E5766 [] (called/trimmed by facility)
GAAGAATTACAGCTCTGTTCATCAGAAAGTTTCAATCTTTTTTCTTTTATCTCCAAAGTTACTGTCATTTCTTGATGTAGAGGAAGATTCTTGAG
TTCACACTAGATCTGGGGTTCAATGAACTTTGGGGGTTTGTATTTAAGTAACAACTGGTGTTAATCTGTGCATATAATGCTGAAAACTTGAGTTT
TGCAGTTTGTCTGGTGGCTAGTGGCTAGTGGAGCTAAAAAGATTGAATTTTGGGGTGTTTTTTGCTCTAATGGGGATTTGTCTGAGTAACCAAAT
CAAGGCTGAGACAACATTTTATACTGTTTCAGGGTTGGATTCAAGAAATGTCAGTGGAAATGGTACAGATATTACTAATTCGAATAGCAAACGCT
CATCTGCTTCCGTACCGCCGACTCCTCGGAGTGAGGGTGAGATCTTGCAATCATCCAACTTGAGGAGCTTCACTTTCAGTGAACTTCGATCTGCA
ACCAGAAATTTCCGCCCTGACAGTGTAGTTGGAGAAGGAGGTTTTGGTTCAGTTTTCAAAGGGTGGGTCGACGAACATACTCTTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T177935 [Download] [View] Facility Assigned ID: TPTAG21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence