EST details — SGN-E577603

Search information 
Request: 577603Match: SGN-E577603
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C354708Clone name: LE15AF02
nocartOrdering Not Available
Library Name: LE15Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: 15 days post anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E577603Length: 621 bp (858 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E577603 [] (trimmed) TATTAATGAACACAGTAATAATATAGAAAATAGACATCCATATGGAGCCCAAAACTTTGTTCTGGGCTCTTTTGAAAGCCCAATAATGAAGTACT
AAGTAGGGCCACAATTACATAATTGTGCATCCTTGACCATCTTCTTCATTATAGTAATCATTGTTTCCGTAATAACCCTTTCCATAGCTAGATGG
GCCCGGGCCGGGCCCATATCCATACGAGTAGTTACCGTAGTATGGGGCGGGTTGTGGGGGTACGGGTGTTCCATAATATTGATAACACGGGCCAC
CGGTATAATGGCATTGCCCACAGCCACAACTTGGCATTACCTGGGGGTATCCGTGGACCGGAGGCATCATCATTATTGGTTCGGATATCCATGGG
GTTTCTTCTCTGGTTCTTTGGGCTTTTCGGGCTTTTCCTTGGGCTTTTCGGGCTCCTTGGGCTTTTCAGGAGCTTTGAGCTTTAAGGGCTCTTTG
ATCTCAATGCTCTTGATTGCTTTTCCTCCTTTACACACAATTTGTCGCGAATCCGTTCANGACTGCAACAAACTACAAGGATGGTGATAGTGTTG
GCCTTCTCATCATACATTTGATCTCGAACCTGAAGCATTTTGCAGAGAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E577603] SGN-U593623 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T378634 [Download][View] Facility Assigned ID: LE15AF02
Submitter: Virginie Garcia Sequencing Facility: PRI
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5