EST details — SGN-E577706

Search information 
Request: 577706Match: SGN-E577706
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C354811Clone name: LE15CA11
nocartOrdering Not Available
Library Name: LE15Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: 15 days post anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E577706Length: 773 bp (911 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E577706 [] (trimmed) CAAGCACTCATCCGAATGCGTTATCTGAGATGGACAAATACAGTAACAAAGGACTCCCTTCTTGCGGAGGTACAAACATAGATGGATTGGACAAA
TAGTTATTATTGCTTCAAAAGCAATCTGAAACTCTTCAGTCCACTTTGTCAAATCATCTTTTTTCAACAACTTGAAGATAGACTCACACACCATA
GTTAATTGGGATATGAATTTACTGATGTAGTTTAACTTGCCCAAGAAACTCATCACTTCCTTCTTATTCTTTAGAGGAGGTAACTCTTGAATCTC
CTTAATCTTGGAAGGTTCAAGCTCAATGCCCCTTCTGCTGACTACAAATCCGAATAATTTACCGGCAGGAACTCCAAAGGCATATTTGGCGGGAT
TTAACTTTTAAGTTATACCAATGCAGAAGGTCAAAAAACTTCTTCAAGTGTGTCAAGTGGTCCAAACTCTCGCGGGACTTTATTAATGACGTCAT
CTACATACACCTCGATCTCCTTATGAATCATATCGTGAAATGTGGTTGTCATAGCCCTCATATAGGTAGAACCAACATTCTTGAGGCCAAGTGGC
ATCACCCTGTATTAATATATACCCCCAAGGTGTAATTAAAGCTGTCTTTTCTTCATCTTCTTCGTCCATCAGAATCTGATGATAACCTGCATATT
AATCCACAAATGACTGCATTTCATGTTTAGAAGCTATCGATCACAATTTTAATATTCGGCAATGGAAAATTATCCTTAGGGATGGCTTTGTTGAG
ATNCCCGTAGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E577706] SGN-U602741 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T378662 [Download][View] Facility Assigned ID: LE15CA11
Submitter: Virginie Garcia Sequencing Facility: PRI
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5