EST details — SGN-E578067

Search information 
Request: 578067Match: SGN-E578067
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C355172Clone name: LE08DF01
nocartOrdering Not Available
Library Name: LE08Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: 8 days post anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E578067Length: 291 bp (869 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E578067 [] (trimmed) AGTAATGAGCATAACGGCCCTATTGTTCCGATGGAGAGAAGAACCTATGATTAGCTTTTCGGGAAATTTCCAAACGAACAATTTCAACGAAATCT
TTCAATTTCTTATTTTACTATGTTCACCATGATGAATGATATGTCTCATGGTGCAAATTATATGAAGCTTCAAATCAGCATGGTGAAAATTATGG
CATATGCTCTAGCGCTCATCATAATGAATGATGTGTCTCACGGTGCCAATTGCATGATGCTTCAAATTGGCAGGACAAAAATTATGGTATATGCT
CTAGCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E578067] SGN-U601612 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T378869 [Download] [View] Facility Assigned ID: LE08DF01
Submitter: Virginie Garcia Sequencing Facility: PRI
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5