EST details — SGN-E578070

Search information 
Request: 578070Match: SGN-E578070
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C355175Clone name: LE08DF06
nocartOrdering Not Available
Library Name: LE08Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: 8 days post anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E578070Length: 223 bp (799 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E578070 [] (trimmed) GTAAAATCTCCCTTCCCAAATAAATAAGTTTGTTAATGAATCTCTTGATTTATTTGAAAAACAAGTAGGACACGTTTTCTCTAGTTTTTTAGGGA
TCTACCAAGGAGTTCCATTACTGGCTCGTAGATTCGCTCATGACATTGTCATCTTGATACTATTGAAGTAGCTCATTTCAAATTCAAACATGGGT
TTGATTCACACTCCATGTTCTGAGGGGGGGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E578070] SGN-U596305 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T378872 [Download] [View] Facility Assigned ID: LE08DF06
Submitter: Virginie Garcia Sequencing Facility: PRI
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5