EST details — SGN-E578452
| Search information |
| Request: 578452 | Match: SGN-E578452 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C355557 | Clone name: 85569 |
| ||
| Library Name: STOL | Organism: Solanum tuberosum |
Tissue: Stolon
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E578452 | Length: 203 bp (284 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E578452 [] (trimmed)
GAGACTTTATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGTGCTGTCCTCATTATTGACTCCACCACTGGTGGTTTTGAAGCTGGTATC
TCTAAAGATGGTCAGACCGTGAACATGCATTGTTGCTTCACCTTGGTGTCAGCAATGATCTGTGTTGTACCAAGATGGATGTTACCACCCCCAAG
TACTCCAAGGCTA
TCTAAAGATGGTCAGACCGTGAACATGCATTGTTGCTTCACCTTGGTGTCAGCAATGATCTGTGTTGTACCAAGATGGATGTTACCACCCCCAAG
TACTCCAAGGCTA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E578452] | SGN-U289657 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T379328 [Download][View] | Facility Assigned ID: bf_stolxxxx_0053b05.t3m |
| Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.949 | Expected Error Rate: 0.0344 | Quality Trim Threshold: 14.5 |
Working
