EST details — SGN-E581500

Search information 
Request: 581500Match: SGN-E581500
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C359652Clone name: 6699
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C359652 [6699] Trace: SGN-T382331 EST: SGN-E581499 Direction: 5' Facility: GASF
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E581500Length: 279 bp (879 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E581500 [] (trimmed) GATGAAAAGAAAAAAAGACTATTTTTTTATGCAGTTCTTGGATGGTCCAGTTCACTCAGCTATTCCAGAAGTTGTTGCTAGTAGAAAATCTCTTA
GTTTCAGCCTAGATTCCAATCCAGTATGGGCCTCTCACAGNTATCCAACTCCAGCAGATGCAGGAGTGCTCTGTGTTATTCTAGTGAACACAGCC
ATATCCATCTCCATTGTCAAGGAGATGGTCCGATCGATCCTTCATGTGATTGGCATCCATATTGCATCATGGGACGATTATTCCATCGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E581500] SGN-U270520 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T382423 [Download][View] Facility Assigned ID: ACDA01487D11.skm
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0097 Quality Trim Threshold: 20.5