Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E584265

Search information 
Request: 584265Match: SGN-E584265
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C357224Clone name: 10088
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E584265Length: 682 bp (981 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E584265 [] (trimmed) TCCGATCGCCGTCGCCGATCTCCGTTACACAGAGATGGGGCTGTCTTTCACCAAACTTTTTAGTCGCCCTCTTTGCTAAAGAAAAGAAATGCGTT
ATTCTTATTGGTTGGGTCCTCCGAATGCTGCTGGGTAAAAACCACAAATTTCTCTACAAAGCCTCAAAGTTTGGGGGGGAAAATTGTTACCCACT
ATAACCCTACAAATTGGGCTTCAACGTGGAAACAGTTTGAATACAAGAACATCAGCTTTACCGTGTGGGATGTTGGGGGCCAGTGACAAGATTCG
ACCTCTATGGAGGCATTATTTCCAGAACACACAAGGCCTCATCTTTGTGGTTGACAGCAATGACAGAGACCGTGTTGTTGAGGCAAGGGATGAGC
TTCATAGGATGTTAAATGAGGATGAACTAAGAGAGGCTGTGCTGCTTGTTTTTGCAAACAAACAAGATCTTCCAAACGCAATGAATGCGGCTGAA
ATCACCGATAAACTTGGACTTCATTCTCTTCGACAGCGGCACTGGTATATCCAGAGTGCATGTGCCACCTCTGGAGAAGGGTTATACGAGGGACT
TGATTGGCTATCGAACAATATTTCCAAACCAATGCTTAGATCACTCATTAGACTCTGTCTCGCTTGTCGCTCAATTACCTATATCTGGAGTATAG
TTGTTAACACCATTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E584265] SGN-U286767 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T385141 [Download][View] Facility Assigned ID: ACDA04293F09.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0283 Quality Trim Threshold: 14.5