EST details — SGN-E584508

Search information 
Request: 584508Match: SGN-E584508
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C357467Clone name: 10335
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E584508Length: 403 bp (780 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E584508 [] (trimmed) CTTACCGGACATGCCAATTGTCTTTGCAAGTGATAACTTTCTGCAAATTAACAGGCTTTTCCAGCAAATGAATTTGCTGGGCTATAACTGTAGAT
CTTTTAGTGGGATGGACACAGATTCAAGCTCTCAATTTCGGATAAAAGAATGCATCCAAAATGAACAACCGTGTACACTACGTATGTTAAATTAC
AGAAAAGACGGAACCTCATTTTGGCTTCACATTTCACCTGTCCGGAATGCTTCAGGAAAGGTTGCATACTTTGTCGCTGTTGAGGGTGAAGACTC
ATAACGAGACTAAGGCAGAATCAGGGGTTGAGACAGCGTGGTGTCGTTGCTGCTGTACAAAGTTGCTGTCGACACGCTTGTTCAATGCACTGTGC
AGAACATGCTAGTTCTTGTACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E584508] SGN-U293812 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T385384 [Download][View] Facility Assigned ID: ACDA04549D01.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0262 Quality Trim Threshold: 14.5