EST details — SGN-E589954

Search information 
Request: 589954Match: SGN-E589954
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C366967Clone name: 43540
nocartOrdering Not Available
Library Name: CSCHOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E589954Length: 676 bp (746 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E589954 [] (trimmed) GGAGACTTTTGGGAAACTGGGGAAATTGGAAAAGGTCTCAGAATTGCTCATGGAAATGGAGGCTGGAGGTACGTCGCCCGAGGTTACCTCGTATA
ATGTCTTATTGGAGGCTTATGCACATTTGGGGTCTATGAAAGAGGCTATGGATGTATTTAGGCAAATGCAGGCAGCTGGATGTGTGGCTAATGCA
GAGACTTATAGTATTCTGTTGAATTTATATGGGAAAAATGGGAGATATGATCAGGTTAGGGAGCTTTTCCTTGAGATGAAAACGAGTAATACAGA
GCCAGATGCGGATACATACAATATTCTCATTCAGGTCTTTGGTGAAGGTGGTTACTTTAAGGAGGTGGTAACATTGTTCCATGATATGGTTGAAG
AGAAGGTAGAACCAAATATGGAGACTTATGAAGGGTTGATATATGCCTGTGGAAAGGGAGGGCTTCACGAAGATGCAAAGAGGATTCTGCTACAT
ATGAATGGACAAGGCCTGGTGCCTAGCTCTAAAGTGTATACTGCTGTAATTGAAGCTTATGGACAGGCGGCGCTCTATGAGGAAGCAGTTGTCGC
CTTTAATACGATGAATGAGGTAGGAAGCAGGCCAATGGTGGAGACTTTCAATTCTCTGATCCATACATTTGCTAAAGGGGGACTTTACAAAGAAT
CTGAAGCAATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E589954] SGN-U299074 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T390830 [Download][View] Facility Assigned ID: bf_cschxxxx_0027f08.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5