EST details — SGN-E591307

Search information 
Request: 591307Match: SGN-E591307
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C368320Clone name: 45016
nocartOrdering Not Available
Library Name: CSCHOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E591307Length: 838 bp (958 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E591307 [] (trimmed) ATAACTTGTGTTAGAATAATATGATTGTATGACATAGGAACTGTAGCCAATTAGAGGAGACAAAAGATTCTGGTGGAAAAATAATATTCTACACC
AAGGATTGCTATATAATGGTGCAACTTTGGCAACAAAACATATAGTAAAACATATGGAGGAGCACATTTTCTTATTGATTCTTCTCTTTTTCTCT
GCTTTTGTATCAGCTGCACCCTCAAATGAGACAGACCAAGAAGCTCTACTAGCTTTTCAAAATCTTATTACAAGTCCCAATCATTTTTTGGCCAA
TAATTGGACCAAGAATGCGTCTTTTTGCTCTTGGTTCGGTGTCACGTGCAGTTCAAAAAGGCAACGGGTTGTAGCCTTGAATCTTCCTAATTTAC
AACTTCAAGGCACAATTTCCCCTTCTTTGGCCAATTTGTCCTTTCTTAGAGAGCTCAATCTCGAGAACAACTTATTCCATGGGGGCATCCCTTAT
GGACTTGGCCACTTGCCTCGCTTGCGTGTGATTGATGTTAAAAACAATCAGCTCAACGGAAGTATACCAACAAGTCTATTTCGAACAAAGTCTCG
GGGAGAATTCCAACCTCTACTGGTCTTCATCTTCCAAACCTCTTAGAACTTCACTTGACTGACAATGAGCTTGAAGGGGAAATTCCTCCGCACAT
CACAAATGCCTCCAAGCTTGAAAATTTGAGGTTAGCACACAACTTCTTCAGTGGCAGTATTCCAACTCATTGGGGAAGTCTTCCTGATCTGCGAC
TTCTTTTCCTGCTGCATAGTATGGATGAACATCAGGAACAACTGGACATTAAAACTCTCAAAGAACGTTTACTTCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E591307] SGN-U291029 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T392183 [Download][View] Facility Assigned ID: bf_cschxxxx_0042b06.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5